circad | circRNAs associated with diseases

circPVT1
Gene	PVT1	Organism	Human
Genome Locus	chr8:128902834-128903244:+	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	30537738
Experimental Method
Sample Type	Serum, tissue samples and cell lines	Comparison	forty-five serum samples, sixty-eight cancer tissues and paired adjacent noncancerous tissues from primary NSCLC patients were collected
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGACTCTTCCTGGTGAAGCATCTGAT Reverse TACTTGAACGAAGCTCCATGCAGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, X, Zhang, Z, Jiang, H, Li, Q, Wang, R, Pan, H, Niu, Y, Liu, F, Gu, H, Fan, X, Gao, J (2018). Circular RNA circPVT1 Promotes Proliferation and Invasion Through Sponging miR-125b and Activating E2F2 Signaling in Non-Small Cell Lung Cancer. Cell. Physiol. Biochem., 51, 5:2324-2340.